ID: 1085608299_1085608305

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1085608299 1085608305
Species Human (GRCh38) Human (GRCh38)
Location 11:77922819-77922841 11:77922842-77922864
Sequence CCATCATGGCAATCCCATTCCCA TTTTCCAGTGACTGGTTTGCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 20, 4: 211} {0: 3, 1: 0, 2: 3, 3: 32, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!