ID: 1085609343_1085609359

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1085609343 1085609359
Species Human (GRCh38) Human (GRCh38)
Location 11:77933210-77933232 11:77933261-77933283
Sequence CCATCCCCCTCTCCCCACAGTCT TCTGATGCCGAGCCCGAAGCTGG
Strand - +
Off-target summary {0: 3, 1: 77, 2: 525, 3: 436, 4: 1506} {0: 1, 1: 0, 2: 0, 3: 0, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!