ID: 1085610696_1085610707

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1085610696 1085610707
Species Human (GRCh38) Human (GRCh38)
Location 11:77945936-77945958 11:77945984-77946006
Sequence CCTAGCCCAAAGCAACAGCCAAC TAGCCACAGAGCTGCCCAGCAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 3, 3: 27, 4: 236} {0: 4, 1: 0, 2: 0, 3: 48, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!