ID: 1085610698_1085610707

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1085610698 1085610707
Species Human (GRCh38) Human (GRCh38)
Location 11:77945941-77945963 11:77945984-77946006
Sequence CCCAAAGCAACAGCCAACCAGGC TAGCCACAGAGCTGCCCAGCAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 13, 4: 157} {0: 4, 1: 0, 2: 0, 3: 48, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!