ID: 1085618110_1085618117

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1085618110 1085618117
Species Human (GRCh38) Human (GRCh38)
Location 11:78017216-78017238 11:78017254-78017276
Sequence CCAGGGTGGTGGTGTGGAACTCA TCCACAACAGTAGACATCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 280} {0: 1, 1: 0, 2: 0, 3: 8, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!