ID: 1085620326_1085620335

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1085620326 1085620335
Species Human (GRCh38) Human (GRCh38)
Location 11:78033001-78033023 11:78033036-78033058
Sequence CCACTAGGCTGCTGTCAGACCTG CCTCATCTGCAAAATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176} {0: 1, 1: 12, 2: 95, 3: 374, 4: 1109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!