ID: 1085637405_1085637415

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1085637405 1085637415
Species Human (GRCh38) Human (GRCh38)
Location 11:78169214-78169236 11:78169243-78169265
Sequence CCATCAGCCCAGAGCCCCCTGGG GCAGACGTAGGCAGTCAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 473} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!