|
Left Crispr |
Right Crispr |
| Crispr ID |
1085640738 |
1085640742 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:78191118-78191140
|
11:78191162-78191184
|
| Sequence |
CCCAGGGCGTGGCAGTGGGGCTG |
CACATACACACACACACACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 37, 4: 381} |
{0: 18, 1: 1885, 2: 2273, 3: 3370, 4: 5959} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|