ID: 1085687028_1085687035

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1085687028 1085687035
Species Human (GRCh38) Human (GRCh38)
Location 11:78632876-78632898 11:78632921-78632943
Sequence CCTAAGAAAGAATACCAGAATTC TCTGAGCCACAGAAGGAGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 47, 4: 583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!