ID: 1085694729_1085694737

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1085694729 1085694737
Species Human (GRCh38) Human (GRCh38)
Location 11:78694504-78694526 11:78694534-78694556
Sequence CCCAAGATCTGGCCCACTCTGCC ATTTGAGGTGGTGCCTCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 210} {0: 1, 1: 0, 2: 2, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!