ID: 1085703173_1085703184

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1085703173 1085703184
Species Human (GRCh38) Human (GRCh38)
Location 11:78763332-78763354 11:78763361-78763383
Sequence CCATGCTGCACTCGAGTGGCCCC GGAGTGGAGGGCAAAGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116} {0: 1, 1: 2, 2: 10, 3: 76, 4: 791}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!