ID: 1085703199_1085703204

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1085703199 1085703204
Species Human (GRCh38) Human (GRCh38)
Location 11:78763451-78763473 11:78763480-78763502
Sequence CCTGACCCTTGAACTTGAAGCTC GCTCACATGCTGCTGGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176} {0: 1, 1: 0, 2: 1, 3: 15, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!