ID: 1085708991_1085708999

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1085708991 1085708999
Species Human (GRCh38) Human (GRCh38)
Location 11:78812271-78812293 11:78812298-78812320
Sequence CCTTTCATGTATTGGCCATTTCC CAGAGCACGGGGCAGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180} {0: 1, 1: 0, 2: 8, 3: 79, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!