ID: 1085712360_1085712368

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1085712360 1085712368
Species Human (GRCh38) Human (GRCh38)
Location 11:78841658-78841680 11:78841675-78841697
Sequence CCCCCCTGGCTCCTTTCCCACAG CCACAGCTGACAGCACGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 81, 4: 671} {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!