ID: 1085736735_1085736740

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1085736735 1085736740
Species Human (GRCh38) Human (GRCh38)
Location 11:79045570-79045592 11:79045592-79045614
Sequence CCCTGGCCTGGCTGCTACTGGAG GCTCAGGCTGCAGAGGAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 294} {0: 1, 1: 0, 2: 3, 3: 115, 4: 1457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!