ID: 1085748774_1085748783

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1085748774 1085748783
Species Human (GRCh38) Human (GRCh38)
Location 11:79140537-79140559 11:79140569-79140591
Sequence CCTTTAAAATCCCCACATTTCCC CTGCTCTGCCTGGCAGAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 323} {0: 1, 1: 0, 2: 3, 3: 33, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!