ID: 1085751702_1085751710

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1085751702 1085751710
Species Human (GRCh38) Human (GRCh38)
Location 11:79167816-79167838 11:79167839-79167861
Sequence CCAGGCTCCTTCTGTGTCCACAG GGCCTGCAAAACTGTGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 432} {0: 1, 1: 0, 2: 1, 3: 24, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!