ID: 1085769024_1085769032

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1085769024 1085769032
Species Human (GRCh38) Human (GRCh38)
Location 11:79308765-79308787 11:79308817-79308839
Sequence CCACCTCCTGAGTGCGAGACCCA TAGTTTCCTCACCCGTAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 138} {0: 1, 1: 18, 2: 360, 3: 2532, 4: 8258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!