ID: 1085769564_1085769573

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1085769564 1085769573
Species Human (GRCh38) Human (GRCh38)
Location 11:79312718-79312740 11:79312769-79312791
Sequence CCCAACACTTCTTGGTTGGAAGG TGGAATGGACACCTGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 180} {0: 1, 1: 0, 2: 1, 3: 28, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!