ID: 1085774536_1085774539

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1085774536 1085774539
Species Human (GRCh38) Human (GRCh38)
Location 11:79353291-79353313 11:79353305-79353327
Sequence CCCTTTAAATCTATCTGATAAAA CTGATAAAACAGATCTTACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 491} {0: 1, 1: 0, 2: 0, 3: 20, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!