ID: 1085797931_1085797935

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1085797931 1085797935
Species Human (GRCh38) Human (GRCh38)
Location 11:79560616-79560638 11:79560665-79560687
Sequence CCTGGGATTTCTTAGATACTATG CTATTTACATATATGCAGCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!