ID: 1085834503_1085834505

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1085834503 1085834505
Species Human (GRCh38) Human (GRCh38)
Location 11:79937901-79937923 11:79937920-79937942
Sequence CCATCTTTTGCATATATAGTCAT TCATCCCTTGGTATTTGTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 24, 3: 119, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!