ID: 1085884444_1085884456

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1085884444 1085884456
Species Human (GRCh38) Human (GRCh38)
Location 11:80505842-80505864 11:80505892-80505914
Sequence CCAGCGTAGCAGTCTCAAGTCGG AGGGGCGTCCACCATTACTGAGG
Strand - +
Off-target summary No data {0: 84, 1: 419, 2: 900, 3: 1384, 4: 1803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!