ID: 1085941903_1085941906

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1085941903 1085941906
Species Human (GRCh38) Human (GRCh38)
Location 11:81214631-81214653 11:81214659-81214681
Sequence CCCTAAATCATCTCTCTCAAGTT TTCCACAAGTCTCTACAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 27, 2: 108, 3: 1123, 4: 2069}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!