ID: 1085963932_1085963936

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1085963932 1085963936
Species Human (GRCh38) Human (GRCh38)
Location 11:81498054-81498076 11:81498085-81498107
Sequence CCCAATAAGATCTCAGGAGTTGG GCTCAAGTATGTGCATTAAAAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 45, 3: 132, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!