ID: 1086113063_1086113072

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1086113063 1086113072
Species Human (GRCh38) Human (GRCh38)
Location 11:83219424-83219446 11:83219476-83219498
Sequence CCTGGCCATAAAACTGTCCTTCA GCGTATAGTAAGTTTAAAGGGGG
Strand - +
Off-target summary {0: 8, 1: 6, 2: 3, 3: 13, 4: 226} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!