ID: 1086119019_1086119031

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1086119019 1086119031
Species Human (GRCh38) Human (GRCh38)
Location 11:83286278-83286300 11:83286327-83286349
Sequence CCTGGCAGTGGGGCATAGTCCAA GGCCATTACGCGCTTGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120} {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!