ID: 1086119026_1086119030

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1086119026 1086119030
Species Human (GRCh38) Human (GRCh38)
Location 11:83286313-83286335 11:83286326-83286348
Sequence CCAAGATAGCCAGCGGCCATTAC CGGCCATTACGCGCTTGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31} {0: 1, 1: 0, 2: 0, 3: 1, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!