ID: 1086127695_1086127700

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1086127695 1086127700
Species Human (GRCh38) Human (GRCh38)
Location 11:83366115-83366137 11:83366162-83366184
Sequence CCACTAGGAATGAACAAATGTCT GGTCTCACTCTGGAGTGCAATGG
Strand - +
Off-target summary No data {0: 1, 1: 13, 2: 82, 3: 198, 4: 1003}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!