ID: 1086163449_1086163456

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1086163449 1086163456
Species Human (GRCh38) Human (GRCh38)
Location 11:83749377-83749399 11:83749426-83749448
Sequence CCAAGAAAAAGATGCAAATCCTG CCACAAGGCCTAGGAATAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 795} {0: 1, 1: 0, 2: 2, 3: 27, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!