ID: 1086167651_1086167653

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1086167651 1086167653
Species Human (GRCh38) Human (GRCh38)
Location 11:83798065-83798087 11:83798083-83798105
Sequence CCTTGGAGATGCTGCTTAGAAGG GAAGGCAGAGCAAATGCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 195} {0: 1, 1: 1, 2: 3, 3: 30, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!