ID: 1086167976_1086167979

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1086167976 1086167979
Species Human (GRCh38) Human (GRCh38)
Location 11:83801531-83801553 11:83801546-83801568
Sequence CCAAGTTTCCTCCAGTCTTACAG TCTTACAGCATTTATGCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179} {0: 1, 1: 0, 2: 1, 3: 16, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!