ID: 1086222878_1086222881

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1086222878 1086222881
Species Human (GRCh38) Human (GRCh38)
Location 11:84471110-84471132 11:84471128-84471150
Sequence CCATCAGCTAGTAACATTCTGGC CTGGCAACCCAGATGGAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118} {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!