ID: 1086252015_1086252023

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1086252015 1086252023
Species Human (GRCh38) Human (GRCh38)
Location 11:84827219-84827241 11:84827256-84827278
Sequence CCTTATGTTAAAGTCTCTCACTA GGGCATCATGGTAATAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 200} {0: 1, 1: 0, 2: 2, 3: 8, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!