ID: 1086262482_1086262484

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1086262482 1086262484
Species Human (GRCh38) Human (GRCh38)
Location 11:84957168-84957190 11:84957187-84957209
Sequence CCCAAGATCACATGGGACAGGAC GGACTCAAACCTAGACTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 127} {0: 1, 1: 1, 2: 1, 3: 28, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!