ID: 1086266270_1086266275

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1086266270 1086266275
Species Human (GRCh38) Human (GRCh38)
Location 11:85002254-85002276 11:85002292-85002314
Sequence CCTGATTTGGCTAGTTGCTAGTC TGGGATTGCCTTAAAAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 97} {0: 1, 1: 0, 2: 2, 3: 19, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!