ID: 1086272208_1086272213

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1086272208 1086272213
Species Human (GRCh38) Human (GRCh38)
Location 11:85081180-85081202 11:85081233-85081255
Sequence CCATTTATATAACCTGAAAGTCA AGACATGGGAATAGTGTGTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 75, 4: 334} {0: 1, 1: 0, 2: 2, 3: 11, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!