|
Left Crispr |
Right Crispr |
Crispr ID |
1086278055 |
1086278059 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
11:85155609-85155631
|
11:85155624-85155646
|
Sequence |
CCTGTAATCTCAGTACTTTAGAA |
CTTTAGAAGGCCAAGGAGGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 105, 2: 3169, 3: 48750, 4: 355113} |
{0: 2, 1: 25, 2: 524, 3: 8118, 4: 62602} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|