ID: 1086286885_1086286898

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1086286885 1086286898
Species Human (GRCh38) Human (GRCh38)
Location 11:85261521-85261543 11:85261559-85261581
Sequence CCCCGTGGGCCATTGTCCTGGAT ATTGGATCTTGCGGGAGGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 98} {0: 1, 1: 2, 2: 5, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!