ID: 1086301837_1086301841

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1086301837 1086301841
Species Human (GRCh38) Human (GRCh38)
Location 11:85434767-85434789 11:85434803-85434825
Sequence CCCTCAGACTATTCCAAACAGTT TTCTCCCAGCTCATTTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 147} {0: 1, 1: 1, 2: 13, 3: 109, 4: 595}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!