ID: 1086307187_1086307190

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1086307187 1086307190
Species Human (GRCh38) Human (GRCh38)
Location 11:85493979-85494001 11:85494009-85494031
Sequence CCTTGTTGCTGCATCCTCTGGAG AAATCATGTCTTCATATGACAGG
Strand - +
Off-target summary {0: 20, 1: 59, 2: 144, 3: 207, 4: 469} {0: 1, 1: 0, 2: 1, 3: 22, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!