ID: 1086342108_1086342120

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1086342108 1086342120
Species Human (GRCh38) Human (GRCh38)
Location 11:85857333-85857355 11:85857385-85857407
Sequence CCAGGACCATGAGGCAGCTGCCA CTGGAAGGGCGAAACAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 45, 4: 376} {0: 1, 1: 1, 2: 2, 3: 20, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!