ID: 1086342853_1086342859

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1086342853 1086342859
Species Human (GRCh38) Human (GRCh38)
Location 11:85865000-85865022 11:85865029-85865051
Sequence CCAGTATTAAGTCCCAGAGGTAC TAGAGTAAACAAAAGTAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 61} {0: 1, 1: 0, 2: 2, 3: 15, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!