ID: 1086402033_1086402035

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1086402033 1086402035
Species Human (GRCh38) Human (GRCh38)
Location 11:86468886-86468908 11:86468902-86468924
Sequence CCTTATGATGTAGGCGCTGTTTC CTGTTTCCAGAGAAGGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 138} {0: 1, 1: 0, 2: 2, 3: 29, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!