|
Left Crispr |
Right Crispr |
| Crispr ID |
1086418434 |
1086418437 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:86613172-86613194
|
11:86613190-86613212
|
| Sequence |
CCCCATTGCTTATTTTTTCAGGT |
CAGGTTTGTCGAAGATCAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 17, 2: 108, 3: 175, 4: 640} |
{0: 226, 1: 6443, 2: 4435, 3: 2408, 4: 1876} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|