ID: 1086447890_1086447898

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1086447890 1086447898
Species Human (GRCh38) Human (GRCh38)
Location 11:86887338-86887360 11:86887373-86887395
Sequence CCCAAGATGTGAAATGGGAAATG AAGGGGTCAAAAAAACAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 544} {0: 1, 1: 0, 2: 1, 3: 15, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!