ID: 1086452650_1086452660

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1086452650 1086452660
Species Human (GRCh38) Human (GRCh38)
Location 11:86932406-86932428 11:86932443-86932465
Sequence CCATCAGTGACACGGCCACCCAG TGCTGGGGGCTGAGAGTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126} {0: 1, 1: 0, 2: 5, 3: 69, 4: 766}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!