|
Left Crispr |
Right Crispr |
| Crispr ID |
1086454387 |
1086454393 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:86947010-86947032
|
11:86947040-86947062
|
| Sequence |
CCTGGCCAACACAGTGAAACCCC |
CTAAAAATACAGAAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1798, 1: 23902, 2: 126584, 3: 203942, 4: 210471} |
{0: 3, 1: 211, 2: 8927, 3: 22915, 4: 15202} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|