|
Left Crispr |
Right Crispr |
| Crispr ID |
1086454388 |
1086454393 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:86947015-86947037
|
11:86947040-86947062
|
| Sequence |
CCAACACAGTGAAACCCCGTCTC |
CTAAAAATACAGAAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 941, 1: 8626, 2: 53354, 3: 138542, 4: 139207} |
{0: 3, 1: 211, 2: 8927, 3: 22915, 4: 15202} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|