|
Left Crispr |
Right Crispr |
| Crispr ID |
1086473736 |
1086473743 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:87147054-87147076
|
11:87147074-87147096
|
| Sequence |
CCTCACACCAGTAATCCCAGCAC |
CACTCTGGGAAGCCGAGACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 776, 2: 1983, 3: 2836, 4: 2591} |
{0: 1, 1: 2, 2: 77, 3: 979, 4: 3116} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|